IthaID: 37
Names and Sequences
Functionality: | Neutral polymorphism | Pathogenicity: | Benign / Likely Benign |
---|---|---|---|
Common Name: | CAP +20 C>T; IVS II-745 C>G | HGVS Name: | HBB:c.[-31C>T;316-106C>G] |
Context nucleotide sequence:
TTGCTTACATTTGCTTCTGACACAA [C/T] TGTGTTCACTAGCAACCTCAAACAG (Strand: -)
Also known as:
Comments: This mutation is an innocuous SNP associated with the IVSII-745 mutation in cis.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
Allele Phenotype: | Neutral |
---|---|
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70564 or 71784 |
Size: | 1 bp or 1 bp |
Located at: | β |
Specific Location: | 5'UTR |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | 5'UTR (Transcription) |
Ethnic Origin: | Bulgarian, Iranian, Mediterranean |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Frequencies
Publications / Origin
- Galehdari H, Salehi B, Pedram M, Oraki Kohshour M, High prevalence of rare mutations in the Beta globin gene in an ethnic group in iran., Iran Red Crescent Med J, 13(5), 356-8, 2011 PubMed
- Ropero P, González FA, Cela E, Beléndez C, Cervera A, Martínez-Nieto J, de la Fuente-Gonzalo F, Vinuesa L, Villegas A, Díaz-Mediavilla J, Association in cis of the mutations +20 (C>T) in the 5' untranslated region and IVS-II-745 (C>G) on the β-globin gene., Hemoglobin , 37(2), 112-8, 2013 PubMed
Created on 2010-06-16 16:13:14,
Last reviewed on 2021-09-29 12:13:41 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2010-06-16 16:13:14 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:28:32 | The IthaGenes Curation Team | Reviewed. |
3 | 2014-04-08 11:55:14 | The IthaGenes Curation Team | Reviewed. |
4 | 2014-06-05 08:38:36 | The IthaGenes Curation Team | Reviewed. Functionality corrected. |
5 | 2014-06-05 08:39:46 | The IthaGenes Curation Team | Reviewed. Reference added. |
6 | 2016-09-05 14:53:26 | The IthaGenes Curation Team | Reviewed. |
7 | 2017-06-28 12:20:31 | The IthaGenes Curation Team | Reviewed. |
8 | 2020-09-28 16:44:22 | The IthaGenes Curation Team | Reviewed. Inheritance corrected. |
9 | 2021-09-29 12:13:41 | The IthaGenes Curation Team | Reviewed. HGVS and Common name and locus location corrected. Reference and origin added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-29 12:50:12